Review



origene qstar  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    OriGene origene qstar
    Origene Qstar, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pm41881279-119-11-11?v=OriGene
    Average 94 stars, based on 28 article reviews
    origene qstar - by Bioz Stars, 2026-07
    94/100 stars

    Images



    Similar Products

    origene qstar  (OriGene)
    94
    OriGene origene qstar
    Origene Qstar, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pm41881279-119-11-11?v=OriGene
    Average 94 stars, based on 1 article reviews
    origene qstar - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    origene ta 09 gapdh mouse  (OriGene)
    96
    OriGene origene ta 09 gapdh mouse
    Origene Ta 09 Gapdh Mouse, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pmc11904182__41419_2025_7481_MOESM4_ESM-0-110-110?v=OriGene
    Average 96 stars, based on 1 article reviews
    origene ta 09 gapdh mouse - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    mouse anti-gapdh (origene, #ta802519)  (OriGene)
    90
    OriGene mouse anti-gapdh (origene, #ta802519)
    Mouse Anti Gapdh (Origene, #Ta802519), supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pmc12203991-87-32-35?v=OriGene
    Average 90 stars, based on 1 article reviews
    mouse anti-gapdh (origene, #ta802519) - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    sybr green gapdh origene qstar nm002046 f  (OriGene)
    93
    OriGene sybr green gapdh origene qstar nm002046 f
    Study design for RNA extraction and PCR methods. The figure outlines the process used in the study of RNA extraction and PCR methods from stool samples in two cohorts: an evaluation cohort (24 samples: 9 cancer, 8 polyps, 7 controls) and a test cohort (68 samples: 22 cancer, 24 polyps, 22 controls). The evaluation cohort involved multiple RNA extraction methods: Norgen (N), Qiagen (Q), and EasyMAG BioMérieux (EM), with subsequent quality control steps using cel-mir-39 and Oligo-IC mRNA. The PCR methods included two-step RT and <t>GAPDH</t> PCR with a DNA intercalating dye (SYBR green) and TaqMan probes, and one-step GAPDH RT-PCR with TaqMan probes. In the test cohort, RNA extraction was performed using Norgen (N), followed by one-step RT-PCR with TaqMan probes targeting GAPDH, CXCL1, IL18, IL1B, IL6, PTGS2 , and SPP1 .
    Sybr Green Gapdh Origene Qstar Nm002046 F, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pmc11551167-22-57-61?v=OriGene
    Average 93 stars, based on 1 article reviews
    sybr green gapdh origene qstar nm002046 f - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    gapdh gtctcctctgacttcaacagcg accaccctgttgctgtagccaa origene  (OriGene)
    95
    OriGene gapdh gtctcctctgacttcaacagcg accaccctgttgctgtagccaa origene
    Study design for RNA extraction and PCR methods. The figure outlines the process used in the study of RNA extraction and PCR methods from stool samples in two cohorts: an evaluation cohort (24 samples: 9 cancer, 8 polyps, 7 controls) and a test cohort (68 samples: 22 cancer, 24 polyps, 22 controls). The evaluation cohort involved multiple RNA extraction methods: Norgen (N), Qiagen (Q), and EasyMAG BioMérieux (EM), with subsequent quality control steps using cel-mir-39 and Oligo-IC mRNA. The PCR methods included two-step RT and <t>GAPDH</t> PCR with a DNA intercalating dye (SYBR green) and TaqMan probes, and one-step GAPDH RT-PCR with TaqMan probes. In the test cohort, RNA extraction was performed using Norgen (N), followed by one-step RT-PCR with TaqMan probes targeting GAPDH, CXCL1, IL18, IL1B, IL6, PTGS2 , and SPP1 .
    Gapdh Gtctcctctgacttcaacagcg Accaccctgttgctgtagccaa Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pm39289808__cb4c00443_si_001-140-0-3?v=OriGene
    Average 95 stars, based on 1 article reviews
    gapdh gtctcctctgacttcaacagcg accaccctgttgctgtagccaa origene - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    gapdh origene ta802519  (OriGene)
    96
    OriGene gapdh origene ta802519
    Study design for RNA extraction and PCR methods. The figure outlines the process used in the study of RNA extraction and PCR methods from stool samples in two cohorts: an evaluation cohort (24 samples: 9 cancer, 8 polyps, 7 controls) and a test cohort (68 samples: 22 cancer, 24 polyps, 22 controls). The evaluation cohort involved multiple RNA extraction methods: Norgen (N), Qiagen (Q), and EasyMAG BioMérieux (EM), with subsequent quality control steps using cel-mir-39 and Oligo-IC mRNA. The PCR methods included two-step RT and <t>GAPDH</t> PCR with a DNA intercalating dye (SYBR green) and TaqMan probes, and one-step GAPDH RT-PCR with TaqMan probes. In the test cohort, RNA extraction was performed using Norgen (N), followed by one-step RT-PCR with TaqMan probes targeting GAPDH, CXCL1, IL18, IL1B, IL6, PTGS2 , and SPP1 .
    Gapdh Origene Ta802519, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pmc11347582__41419_2024_7017_MOESM1_ESM-85-12-13?v=OriGene
    Average 96 stars, based on 1 article reviews
    gapdh origene ta802519 - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    gapdh housekeeping origene rockville md  (OriGene)
    86
    OriGene gapdh housekeeping origene rockville md
    Study design for RNA extraction and PCR methods. The figure outlines the process used in the study of RNA extraction and PCR methods from stool samples in two cohorts: an evaluation cohort (24 samples: 9 cancer, 8 polyps, 7 controls) and a test cohort (68 samples: 22 cancer, 24 polyps, 22 controls). The evaluation cohort involved multiple RNA extraction methods: Norgen (N), Qiagen (Q), and EasyMAG BioMérieux (EM), with subsequent quality control steps using cel-mir-39 and Oligo-IC mRNA. The PCR methods included two-step RT and <t>GAPDH</t> PCR with a DNA intercalating dye (SYBR green) and TaqMan probes, and one-step GAPDH RT-PCR with TaqMan probes. In the test cohort, RNA extraction was performed using Norgen (N), followed by one-step RT-PCR with TaqMan probes targeting GAPDH, CXCL1, IL18, IL1B, IL6, PTGS2 , and SPP1 .
    Gapdh Housekeeping Origene Rockville Md, supplied by OriGene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pmc11210377-445-8-10?v=OriGene
    Average 86 stars, based on 1 article reviews
    gapdh housekeeping origene rockville md - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    mp202402 gapdh mouse qpcr primer pair origene  (OriGene)
    92
    OriGene mp202402 gapdh mouse qpcr primer pair origene
    Study design for RNA extraction and PCR methods. The figure outlines the process used in the study of RNA extraction and PCR methods from stool samples in two cohorts: an evaluation cohort (24 samples: 9 cancer, 8 polyps, 7 controls) and a test cohort (68 samples: 22 cancer, 24 polyps, 22 controls). The evaluation cohort involved multiple RNA extraction methods: Norgen (N), Qiagen (Q), and EasyMAG BioMérieux (EM), with subsequent quality control steps using cel-mir-39 and Oligo-IC mRNA. The PCR methods included two-step RT and <t>GAPDH</t> PCR with a DNA intercalating dye (SYBR green) and TaqMan probes, and one-step GAPDH RT-PCR with TaqMan probes. In the test cohort, RNA extraction was performed using Norgen (N), followed by one-step RT-PCR with TaqMan probes targeting GAPDH, CXCL1, IL18, IL1B, IL6, PTGS2 , and SPP1 .
    Mp202402 Gapdh Mouse Qpcr Primer Pair Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pm38761377-260-103-109?v=OriGene
    Average 92 stars, based on 1 article reviews
    mp202402 gapdh mouse qpcr primer pair origene - by Bioz Stars, 2026-07
    92/100 stars
    		  Buy from Supplier
    rc202309 acta2 nm 001613 origene technologies  (OriGene)
    92
    OriGene rc202309 acta2 nm 001613 origene technologies
    Study design for RNA extraction and PCR methods. The figure outlines the process used in the study of RNA extraction and PCR methods from stool samples in two cohorts: an evaluation cohort (24 samples: 9 cancer, 8 polyps, 7 controls) and a test cohort (68 samples: 22 cancer, 24 polyps, 22 controls). The evaluation cohort involved multiple RNA extraction methods: Norgen (N), Qiagen (Q), and EasyMAG BioMérieux (EM), with subsequent quality control steps using cel-mir-39 and Oligo-IC mRNA. The PCR methods included two-step RT and <t>GAPDH</t> PCR with a DNA intercalating dye (SYBR green) and TaqMan probes, and one-step GAPDH RT-PCR with TaqMan probes. In the test cohort, RNA extraction was performed using Norgen (N), followed by one-step RT-PCR with TaqMan probes targeting GAPDH, CXCL1, IL18, IL1B, IL6, PTGS2 , and SPP1 .
    Rc202309 Acta2 Nm 001613 Origene Technologies, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+origene/pmc10797555__mmc1-3-76-79?v=OriGene
    Average 92 stars, based on 1 article reviews
    rc202309 acta2 nm 001613 origene technologies - by Bioz Stars, 2026-07
    92/100 stars
    		  Buy from Supplier

    Image Search Results


    Study design for RNA extraction and PCR methods. The figure outlines the process used in the study of RNA extraction and PCR methods from stool samples in two cohorts: an evaluation cohort (24 samples: 9 cancer, 8 polyps, 7 controls) and a test cohort (68 samples: 22 cancer, 24 polyps, 22 controls). The evaluation cohort involved multiple RNA extraction methods: Norgen (N), Qiagen (Q), and EasyMAG BioMérieux (EM), with subsequent quality control steps using cel-mir-39 and Oligo-IC mRNA. The PCR methods included two-step RT and GAPDH PCR with a DNA intercalating dye (SYBR green) and TaqMan probes, and one-step GAPDH RT-PCR with TaqMan probes. In the test cohort, RNA extraction was performed using Norgen (N), followed by one-step RT-PCR with TaqMan probes targeting GAPDH, CXCL1, IL18, IL1B, IL6, PTGS2 , and SPP1 .

    Journal: Scientific Reports

    Article Title: Selection of optimal extraction and RT-PCR protocols for stool RNA detection of colorectal cancer associated immune genes

    doi: 10.1038/s41598-024-78680-0

    Figure Lengend Snippet: Study design for RNA extraction and PCR methods. The figure outlines the process used in the study of RNA extraction and PCR methods from stool samples in two cohorts: an evaluation cohort (24 samples: 9 cancer, 8 polyps, 7 controls) and a test cohort (68 samples: 22 cancer, 24 polyps, 22 controls). The evaluation cohort involved multiple RNA extraction methods: Norgen (N), Qiagen (Q), and EasyMAG BioMérieux (EM), with subsequent quality control steps using cel-mir-39 and Oligo-IC mRNA. The PCR methods included two-step RT and GAPDH PCR with a DNA intercalating dye (SYBR green) and TaqMan probes, and one-step GAPDH RT-PCR with TaqMan probes. In the test cohort, RNA extraction was performed using Norgen (N), followed by one-step RT-PCR with TaqMan probes targeting GAPDH, CXCL1, IL18, IL1B, IL6, PTGS2 , and SPP1 .

    Article Snippet: 250 ng RNA*. iScript cDNA synthesis kit (Biorad). 20 μl volume. Random hexamer primers. , 2 μl undiluted cDNA (approx. 25 ng) Quantinova SYBR Green PCR Kit (Qiagen) , Two-step RT-PCR. RT: 25° C 5 min, 46 °C, 20 min, 95 °C 1 min. PCR: 40 cycles of 5 Sect. 95 °C, 10 Sect. 60 °C. , SYBR green GAPDH : Origene Qstar NM002046 F: 5’ GTCTCCTCTGACTTCAACAGCG-3 R: 5’ACCACCCTGTTGCTGTAGCCAA-3’ (spans exons 7–8).

    Techniques: RNA Extraction, Control, SYBR Green Assay, Reverse Transcription Polymerase Chain Reaction, One Step RT-PCR

    Comparison of extraction methods and PCR methods (Dunn’s test).

    Journal: Scientific Reports

    Article Title: Selection of optimal extraction and RT-PCR protocols for stool RNA detection of colorectal cancer associated immune genes

    doi: 10.1038/s41598-024-78680-0

    Figure Lengend Snippet: Comparison of extraction methods and PCR methods (Dunn’s test).

    Article Snippet: 250 ng RNA*. iScript cDNA synthesis kit (Biorad). 20 μl volume. Random hexamer primers. , 2 μl undiluted cDNA (approx. 25 ng) Quantinova SYBR Green PCR Kit (Qiagen) , Two-step RT-PCR. RT: 25° C 5 min, 46 °C, 20 min, 95 °C 1 min. PCR: 40 cycles of 5 Sect. 95 °C, 10 Sect. 60 °C. , SYBR green GAPDH : Origene Qstar NM002046 F: 5’ GTCTCCTCTGACTTCAACAGCG-3 R: 5’ACCACCCTGTTGCTGTAGCCAA-3’ (spans exons 7–8).

    Techniques: Comparison, Extraction, SYBR Green Assay